Question: If the following is the sequence of an anti-sense strand of DNA, what is the corresponding sequence of the mRNA that codes for the protein? S'TCTGCCCTGACTTTCATGCC 3' A. 5 CCGTACTTTCAGTCCCGTCT 3' B.5 CCGUACUUUCAGUCCCGUCU 3 C.5GGCAUGAAAGUCAGGGCAGA 3 D.5GGCATGAAAGTCAGGGCAGA 3 The authors tested several DNA polymerases to see which one was the least affected by the PCR inhibitors in the clinical sample, and what kinds of PCR enhancers like dithiothreitol (DTT) and KCl were the most effective. They ended up with an assay that is able to diagnose a ZIKV infection, in different biological samples, within 2 h . Plasmids are selfish genetic elements that normally constitute a burden for the bacterial host cell. This burden is expected to favor plasmid loss. Therefore, plasmids have evolved mechanisms to control their replication and ensure their stable maintenance. Replication control can be either mediated by iterons or by antisense RNAs. Nature Reviews Drug Discovery - Antisense technology is now beginning to deliver on its promise to treat diseases by targeting RNA. Here, Crooke and colleagues describe the key technological Vay Tiền Nhanh Ggads.

what is antisense dna